Table of Contents    
ORIGINAL ARTICLE
Year : 2021  |  Volume : 12  |  Issue : 1  |  Page : 12-16  

Comparative analysis of diagnostic methods used for assessing incidence of malaria in two regions from South India


1 Department of Microbiology, Shri B M Medical College Hospital and Research Centre, Vijayapura, Karnataka, India
2 Department of Microbiology, BGS Global Institute of Medical Sciences, Bengaluru, Karnataka, India

Date of Submission14-Jul-2020
Date of Decision18-Aug-2020
Date of Acceptance23-Sep-2020
Date of Web Publication27-Jan-2021

Correspondence Address:
G Mukthayakka
Department of Microbiology, Shri B M Medical College Hospital and Research Centre, Vijayapura - 586 103, Karnataka
India
Login to access the Email id

Source of Support: None, Conflict of Interest: None


DOI: 10.4103/jnsbm.JNSBM_134_20

Rights and Permissions
   Abstract 


Background: Malaria is a vector-borne disease of major public health concern in several tropical and subtropical countries. Five different Plasmodium species are known to cause malaria. For optimal public health measures, region-specific prevalence of Plasmodium species should be identified by optimal diagnostic methods available. In this study, we have detected the malaria incidence rates in two regions of South India and compared the merit of three different diagnostic methods available for detection of malaria. Materials and Methods: Six hundred blood samples from febrile symptomatic patients were screened for malaria from Bengaluru and Vijayapura regions of Karnataka, India, by microscopy, rapid diagnostic test (RDT), and nested polymerase chain reaction (PCR) methods. Results: The incidence rate of malaria in Vijayapura and Bengaluru was 8.6% (26/300) and 7% (21/300), respectively. The rate of malaria infection by Plasmodium vivax was higher in Bengaluru (80.9%) compared to Vijayapura (69%), whereas the rate of Plasmodium falciparum infection was higher in Vijayapura (23%) compared to Bengaluru (14.2%). The mixed infection rate was slightly higher from Vijayapura region. One isolate detected as P. falciparum by microscopy and RDT method was identified as mixed infection by PCR. Three and two isolates which were negative by microscopy and RDT methods, respectively, tested positive by PCR, whereas eight isolates identified as P. vivax by RDT method were negative by PCR and microscopy methods. The sensitivity and specificity of microscopy-based detection method were 93% and 100%, respectively, whereas the sensitivity and specificity of RDT method were observed to be 95% and 75%, respectively. Detection of Plasmodium species by PCR was highly sensitive and specific compared to microscopy or RDT method. Conclusion: The incidence of malaria infection in these regions is moderate. Malaria infection in these regions was caused predominantly by P. vivax. Accuracy of the malaria detection was superior by PCR method compared to conventional methods tested.

Keywords: Malaria, microscopy, Plasmodium falciparum, Plasmodium vivax, polymerase chain reaction, rapid diagnostic test


How to cite this article:
Mukthayakka G, Sajjan AG, Kashid RA. Comparative analysis of diagnostic methods used for assessing incidence of malaria in two regions from South India. J Nat Sc Biol Med 2021;12:12-6

How to cite this URL:
Mukthayakka G, Sajjan AG, Kashid RA. Comparative analysis of diagnostic methods used for assessing incidence of malaria in two regions from South India. J Nat Sc Biol Med [serial online] 2021 [cited 2021 Jun 13];12:12-6. Available from: http://www.jnsbm.org/text.asp?2021/12/1/12/307851




   Introduction Top


Vector-borne diseases are of major public health concern across the globe, especially in tropical and subtropical countries. Among the vector-borne infections, malaria contributes to a high rate of morbidity and mortality.[1],[2] Globally, the incidence of malaria continues to increase[3] and India contributes to one-third of cases of malaria globally with the highest incidence reported by Plasmodium vivax species.[4] The endemicity of malaria is due to complex interactions between vector, host, pathogen, and local environmental factors.[5] Among the five different Plasmodium species known to cause malaria, Plasmodium falciparum and P. vivax are associated with the majority of the infections reported. A detailed understanding of the Plasmodium species involved in epidemiology of malaria is essential for initiating optimal public health measures in different geographical regions. Hence, analyzing and comparing the diagnostic approach used to distinguish between Plasmodium species are essential.

Several diagnostic methods are available for the accurate detection of malaria caused by different Plasmodium species. The commonly used methods are light microscopy (using thick and thin smear) and rapid diagnostic test (RDT: using immunochromatographic lateral flow assay). In addition, advanced techniques such as genotypic detection of Plasmodium species by polymerase chain reaction (PCR), loop-mediated isothermal amplification assay, and flow cytometry are also available for the detection of malaria.[6],[7],[8] Although microscopy is easy to perform and cost-effective, it has several limitations in accurate identification of Plasmodium species causing malaria.[9] A comparison of PCR, sensitivity, and specificity of microscopy and RDT is reported to be low.[10] PCR method targets the amplification of 18S rRNA gene, which is amplified and detected by nested PCR.[4] However, in a clinical setting, due to limitations in the availability of a molecular biology laboratory, PCR method is restricted to laboratory-based diagnosis.[11] This study attempted to determine the incidence rate of malaria in two regions of South India, i.e., Bengaluru and Vijayapura, and compared the diagnostic performance of microscopy and RDT methods with PCR as a gold standard method for detection of malarial infection.


   Materials and Methods Top


The blood samples were collected from symptomatic febrile patients at BGS Global Institute of Medical Sciences, Bengaluru, and BLDE Shri B. M. Patil Medical College, Hospital and Research Centre, Vijayapura. Three hundred convenient blood samples were collected from each center from June 2016 to December 2019. The study was approved (BGSGIMS/GEN/296/2016–17) by the ethics committee from both the institutes. Informed consent was obtained from the patients. Immunocompromised individuals, pregnant women, and patients undergoing anticancer therapy were excluded from the study. The blood samples (5–10 ml) were collected in sterile ethylenediaminetetraacetic acid (EDTA) tubes and stored at −80°C until further analysis. All the samples were tested by microscopy, RDT, and PCR methods.

Microscopy examination was performed by preparing thick and thin smear (peripheral blood smear) using one drop of blood and stained by Giemsa stain (4%). The slide was examined under ×100 magnification under oil immersion objective. RDT method, which is based on immunochromatographic principle, was also performed simultaneously as per manufactures instructions (SD BIOLINE).

DNA extraction and molecular detection of Plasmodium species

Genomic DNA was extracted from 80 positive samples either by microscopy and/or RDT method. 200 μL of blood sample was used for DNA extraction using QIAamp DNA Blood Kit (Qiagen, Hilden, Germany), as per manufacturer's instructions, with modification in the incubation step with proteinase K where duration of incubation time was extended to 20 min at 56°C for better DNA yield. The DNA was dissolved in TE-buffer (10 mM Tris-HCl, 0.1 M EDTA, pH 8.0) and was stored at −20°C until further use. The quality of total DNA was checked by running 5 μL of each DNA sample on a 1.0% agarose gel stained with ethidium bromide and visualized under ultraviolet illumination.

Nested multiplex PCR was performed using the previously published primers.[12] Initially, Plasmodium genus-specific primer pairs were used (rPLU5-5'CCTGTTGTTGCCTTAAACTTC3' and rPLU6-5'TTAAAATTGTTGCAGTTAAAACG3). An amplicon PCR product of 1100 bp was used for further genus-specific identification of P. falciparum using primers (rFAL1-5'-TTAAACTGGTTTGGG AAAACCAAATATATT 3' and rFAL2-5'ACACAATGAACTCAATCATGACTACCCGTC3') and P. vivax (rVIV1-5'CGCTTCTAGCTTAATCCAC ATAACTGATAC3' and rVIV2-5'ACTTCCAAGCCGAAGCAAAGAAAGTCC TTA3'). For both the steps in nested PCR, 20 μL reaction volume was set up using GoTaq® Green 2X Master Mix (Cat.# M7122, PROMEGA GoTaq Green, Madison, WI, USA) containing DNA Taq polymerase, 3 mM MgCl2, 400 μM each dNTP, and 2 μl of genomic DNA as a template in a reaction. No template control was also included with each batch of PCRs as a negative control to check for any chances of contamination in reagents or during reaction setup. The PCR condition for the first step in nested PCR was set up as 95°C for 5 min (initial denaturation) followed by 30 cycles of 94°C for 1 min (denaturation), 60°C for 2 min (annealing), 72°C for 2 min (renaturation), and 72°C for 10 min (final extension). The second PCR conditions set up as 95°C for 5 min (Initial denaturation) followed by 30 cycles of 94°C for 1 min (denaturation), 55°C for 2 min (annealing), 72°C for 2 min (renaturation), and 72°C for 10 min (final extension). These amplicons were run on ethidium bromide gel electrophoresis (1.5%). A primer product of 120 bp was considered as P. falciparum [Figure 1] and 205 bp was considered as P. vivax [Figure 2].[12]
Figure 1: Agarose gel electrophoresis showing band at 120 bp indicative of Plasmodium vivax

Click here to view
Figure 2: Agarose gel electrophoresis showing band at 205 bp indicative of Plasmodium falciparum

Click here to view


Statistical analysis

The data are presented as mean ± standard deviation. Diagnostic performance was assessed using sensitivity, specificity, and positive and negative predictive values, whereas agreement between various tests was assessed using Cohen's kappa. All statistical analyses were performed in OpenEpi v 3.01, and P < 0.05 was considered as level of statistical significance.


   Results Top


The mean age of the study participants was 29.58 ± 9.40 years, with 76.5% of male and 23.4% of female participants. During the study period, the incidence rate of malaria in Vijayapura and Bengaluru was 8.6% (26/300) and 7% (21/300), respectively. The rate of malaria infection by P. vivax was higher in Bengaluru (80.9%) compared to Vijayapura (69%), whereas the rate of P. falciparum infection was higher in Vijayapura (23%) compared to Bengaluru (14.2%) [Table 1]. The mixed infection rate was slightly higher from Vijayapura region [Table 1].
Table 1: Incidence of malaria infection from Bengaluru and Vijayapura

Click here to view


During the study period, a total of 600 individuals from Vijayapura and Bengaluru regions were screened for malaria by microscopy and RDT method, whereas 80 individuals were screened for malaria by PCR method. The details of detection of Plasmodium species are summarized in [Table 2]. The number of positive cases of P. vivax, P. falciparum, and mixed infections detected by microscopy was 33, 10, and 2, respectively. The number of positive cases of P. vivax, P. falciparum, and mixed infections detected by RDT was 42, 10, and 2, respectively, whereas the number of positive cases of P. vivax, P. falciparum, and mixed infections detected by PCR was 35, 9, and 3, respectively. The number of study participants testing negative for malaria by microscopy, RDT, and PCR was observed to be 555, 546, and 53, respectively.
Table 2: Comparison of three methods for detection of Plasmodium species

Click here to view


One isolate detected as P. falciparum by microscopy and RDT method was identified as mixed infection by PCR. Three and two isolates which were negative by microscopy and RDT methods, respectively, tested positive by PCR [Table 3], whereas eight isolates identified as P. vivax by RDT method were negative by PCR and microscopy methods [Table 3]. The sensitivity and specificity of microscopy-based detection method were 93% and 100%, respectively [Table 4], whereas the sensitivity and specificity of RDT method were observed to be 95% and 75%, respectively [Table 4]. Detection of Plasmodium species by PCR was highly sensitive and specific. Among 80 isolates tested, 47 were positive by PCR.
Table 3: Polymerase chain reaction versus conventional tests

Click here to view
Table 4: Diagnostic performance of different test methods for detection of malaria compared with polymerase chain reaction

Click here to view



   Discussion Top


The present study investigated the incidence of malaria infection in two regions of South India from June 2016 to December 2019. We assessed the Plasmodium species by microscopy, RDT, and PCR methods and compared their relative merit in the diagnosis of malaria. The incidence rate of mono (P. vivax or P. falciparum) and mixed infections in the two regions analyzed was considerably different. The epidemiology of the malaria infections and identification of the specific Plasmodium species prevalent in any specific geographical regions is very important as this knowledge helps in optimal policy measures to be initiated for effective prevention of the infections in these regions. Majority of the malaria infections in India are reported to be caused by P. vivax. The proportion of P. vivax and P. falciparum infection in India is reported to be 76:24,[4] which is broadly consistent with the observations from this study. A variation in the prevalence of both the species in India is also reported. One study in 2007 reported an equal prevalence of P. falciparum and P. vivax.[13] An extensive study conducted by Siwal et al., in 2018, from 11 different endemic regions across India reported a 45% prevalence of P. vivax, 42% prevalence of P. falciparum, and 13% prevalence of mixed infection. Contradicting this study, our observations from two regions of South Karnataka suggest a higher prevalence rate (69%–80%) of P. vivax relative to P. falciparum. Difference in the environmental conditions and host factors may account for such difference observed. P. falciparum is predominantly high in eastern, north-eastern, and central regions of India, whereas in Delhi, Uttar Pradesh, Gujarat, and Tamil Nadu states, the prevalence of P. vivax is predominant. While, in some states such as Assam and Madhya Pradesh, either of the species is equally prevalent.[4] In India as per the WHO report and few other epidemiological studies, Orissa state is the major hub for malaria and is often considered as the epicenter for malaria infection in India.[3],[5],[14] The Orissa state also has high diversity in the prevalence of Plasmodium species and as well as incidence of drug-resistant malaria.[15],[16],[17]

In Karnataka state, Mangalore is a highly endemic region for malaria,[4],[18] with a 46.5%, 37.6%, and 15.8% prevalence rate of P. vivax, P. falciparum, and mixed infection, respectively. To the best of our knowledge, our study is the first to report a prevalence rate of P. vivax, P. falciparum, and mixed infection in Bengaluru and Vijayapura regions of Karnataka. This is important as adequate and reliable published literature about the prevalence of malaria in regions other than Mangalore in Karnataka state is lacking.[4] The overall prevalence rate of P. vivax, P. falciparum, and mixed infection in Bengaluru and Vijayapura regions despite being geographically separated by 530 km distance was similar but was considerably different from the Mangalore region. The prevalence of mixed infection is higher in the middle and southwest coastal parts of India.[4] In a similar multicenter study from India, a 13% prevalence rate of mixed infection was reported.[4] However, in contrast to our study, the prevalence rate of mixed infection was very low (5%–8%). Mixed infections are also reported from malaria-endemic tropical countries such as Thailand, Papua New Guinea, and Cambodia.[19],[20],[21] Treatment to mixed malaria infection is always challenging and it is highly relevant to countries like India where mixed infections contribute to a high proportion of severe malaria cases.[22],[23],[24],[25] Majority of the malaria infections (80%) were observed during the monsoon season (June to September), and increased rates of malaria incidence are reported from Mangalore and other regions across India during the monsoon season. Hence, in this study, the data were collected to include the monsoon season.

This study also compared the merit of three different diagnostic methods, i.e., microscopy, RDT, and PCR for the detection of malaria. Genotypic detection of Plasmodium species is performed by PCR as the results from PCR are highly accurate. In a multicentric study by Siwal et al., 2018, PCR method detected approximately 3% higher cases than microscopy, including misdiagnosis of many mixed infections.[4] In our study as well, one mono-infection case of P. falciparum was detected as mixed infection by PCR though this rate is comparatively much lower than that reported by other studies. The factors which influence detection under microscopy are the time of blood sample collection, the abundant presence of different stages of P. falciparum lifecycle comparison to P. vivax, and morphological similarities in gametocytes of P. vivax and P. falciparum.[26],[27] Similarly, RDT also could not detect mixed infection. In RDT method, P. falciparum and P. vivax were detected by targeting histidine-rich protein 2 and lactate dehydrogenase protein, respectively. Mutations and deletions are common phenomena observed in Pfhrp-2 gene which can lead to misdiagnosis in RDT method.[28] Considering all these factors, PCR method is considered the ideal for detection of malaria infection (mono and mixed infection) that otherwise would be overlooked by conventional methods such as microscopy or RDT method. Nevertheless, under resource-constrained conditions, the microscopy method seems to have an advantage over the RDT- or PCR-based methods. Limitations of the study include financial constraints which limited us to perform PCR on only 80 samples among 600 blood samples collected. The follow-up of patients was also not performed to check their clinical outcome.


   Conclusion Top


This study reports the prevalence of malaria in two regions of south India. Bengaluru and Vijayapura had a prevalence of 7% and 8.6%, respectively. Predominant malaria infection was caused by P. vivax (74%). PCR method increased the detection rate of malaria compared to the microscopy or RDT methods. Although PCR is considerably expensive than the conventional method, it should be included in the high endemic regions of India for accurate analysis.

Financial support and sponsorship

Nil.

Conflicts of interest

There are no conflicts of interest.



 
   References Top

1.
Githeko AK, Lindsay SW, Confalonieri UE, Patz JA. Climate change and vector-borne diseases: A regional analysis. Bull World Health Organ 2000;78:1136-47.  Back to cited text no. 1
    
2.
World Health Organization. Fact Sheet: World Malaria Report 2016. World Health Organization. Available from: http://www.who.int/malaria/media/world-malaria-report-2016/en/. [Last accessed on 2020 Jul 14].  Back to cited text no. 2
    
3.
World Health Organization. World Malaria Report 2017. World Health Organization. Available from: http://www.who.int/malaria/publications/world-malaria-report-2017/en/. [Last accessed on 2020 Jul 14].  Back to cited text no. 3
    
4.
Siwal N, Singh US, Dash M, Kar S, Rani S, Rawal C, et al. Malaria diagnosis by PCR revealed differential distribution of mono and mixed species infections by Plasmodium falciparum and P. vivax in India. PLoS One 2018;13:e0193046.  Back to cited text no. 4
    
5.
Das A. The distinctive features of Indian malaria parasites. Trends Parasitol 2015;31:83-6.  Back to cited text no. 5
    
6.
Britton S, Cheng Q, McCarthy JS. Novel molecular diagnostic tools for malaria elimination: A review of options from the point of view of high-throughput and applicability in resource limited settings. Malar J 2016;15:88.  Back to cited text no. 6
    
7.
Lau YL, Fong MY, Mahmud R, Chang PY, Palaeya V, Cheong FW, et al. Specific, sensitive and rapid detection of human plasmodium knowlesi infection by loop-mediated isothermal amplification (LAMP) in blood samples. Malar J 2011;10:197.  Back to cited text no. 7
    
8.
Wongchotigul V, Suwanna N, Krudsood S, Chindanond D, Kano S, Hanaoka N, et al. The use of flow cytometry as a diagnostic test for malaria parasites. Southeast Asian J Trop Med Public Health 2004;35:552-9.  Back to cited text no. 8
    
9.
Payne D. Use and limitations of light microscopy for diagnosing malaria at the primary health care level. Bull World Health Organ 1988;66:621-6.  Back to cited text no. 9
    
10.
World Health Organization. Malaria Rapid Diagnostic Test Performance. Results of WHO Product Testing of Malaria RDTs: Round 8 (2016-2018). World Health Organization. Available from: http://www.who.int/malaria/publications/atoz/9789241514965/en/. [Last accessed on 2020 Jul 14].  Back to cited text no. 10
    
11.
Tangpukdee N, Duangdee C, Wilairatana P, Krudsood S. Malaria diagnosis: A brief review. Korean J Parasitol 2009;47:93-102.  Back to cited text no. 11
    
12.
Johnston SP, Pieniazek NJ, Xayavong MV, Slemenda SB, Wilkins PP, da Silva AJ. PCR as a confirmatory technique for laboratory diagnosis of malaria. J Clin Microbiol 2006;44:1087-9.  Back to cited text no. 12
    
13.
Sharma VP, Dev V, Phookan S. Neglected Plasmodium vivax malaria in northeastern States of India. Indian J Med Res 2015;141:546-55.  Back to cited text no. 13
[PUBMED]  [Full text]  
14.
Singh V, Mishra N, Awasthi G, Dash AP, Das A. Why is it important to study malaria epidemiology in India? Trends Parasitol 2009;25:452-7.  Back to cited text no. 14
    
15.
Jambulingam P, Mohapatra SS, Das LK, Das PK, Rajagopalan PK. Detection of Plasmodium ovale in Koraput district, Orissa state. Indian J Med Res 1989;89:115-6.  Back to cited text no. 15
    
16.
Ranjit MR, Das A, Das BP, Das BN, Dash BP, Chhotray GP. Distribution of Plasmodium falciparum genotypes in clinically mild and severe malaria cases in Orissa, India. Trans R Soc Trop Med Hyg 2005;99:389-95.  Back to cited text no. 16
    
17.
Nandy A, Addy M, Maji AK, Bandyopadhyay AK. Monitoring the chloroquine sensitivity of Plasmodium vivax from Calcutta and Orissa, India. Ann Trop Med Parasitol 2003;97:215-20.  Back to cited text no. 17
    
18.
Joy S, Ghosh SK, Achur RN, Gowda DC, Surolia N. Presence of novel triple mutations in the pvdhfr from Plasmodium vivax in Mangaluru city area in the southwestern coastal region of India. Malar J 2018;17:167.  Back to cited text no. 18
    
19.
Haanshuus CG, Chandy S, Manoharan A, Vivek R, Mathai D, Xena D, et al. A High Malaria Prevalence Identified by PCR among Patients with Acute Undifferentiated Fever in India. PLoS One 2016;11:e0158816.  Back to cited text no. 19
    
20.
Laoboonchai A, Kawamoto F, Thanoosingha N, Kojima S, Scott Miller RR, Kain KC, et al. PCR-based ELISA technique for malaria diagnosis of specimens from Thailand. Trop Med Int Health 2001;6:458-62.  Back to cited text no. 20
    
21.
Steenkeste N, Incardona S, Chy S, Duval L, Ekala MT, Lim P, et al. Towards high-throughput molecular detection of plasmodium: New approaches and molecular markers. Malar J 2009;8:86.  Back to cited text no. 21
    
22.
Snounou G, White NJ. The co-existence of plasmodium: Sidelights from falciparum and vivax malaria in Thailand. Trends Parasitol 2004;20:333-9.  Back to cited text no. 22
    
23.
Looareesuwan S, White NJ, Chittamas S, Bunnag D, Harinasuta T. High rate of Plasmodium vivax relapse following treatment of falciparum malaria in Thailand. Lancet 1987;2:1052-5.  Back to cited text no. 23
    
24.
Ratcliff A, Siswantoro H, Kenangalem E, Maristela R, Wuwung RM, Laihad F, et al. Two fixed-dose artemisinin combinations for drug-resistant falciparum and vivax malaria in Papua, Indonesia: An open-label randomised comparison. Lancet 2007;369:757-65.  Back to cited text no. 24
    
25.
Imwong M, Nakeesathit S, Day NP, White NJ. A review of mixed malaria species infections in anopheline mosquitoes. Malar J 2011;10:253.  Back to cited text no. 25
    
26.
Mayxay M, Pukrittayakamee S, Newton PN, White NJ. Mixed-species malaria infections in humans. Trends Parasitol 2004;20:233-40.  Back to cited text no. 26
    
27.
Bousema T, Drakeley C, Gesase S, Hashim R, Magesa S, Mosha F, et al. Identification of hot spots of malaria transmission for targeted malaria control. J Infect Dis 2010;201:1764-74.  Back to cited text no. 27
    
28.
Maltha J, Gillet P, Jacobs J. Malaria rapid diagnostic tests in endemic settings. Clin Microbiol Infect 2013;19:399-407.  Back to cited text no. 28
    


    Figures

  [Figure 1], [Figure 2]
 
 
    Tables

  [Table 1], [Table 2], [Table 3], [Table 4]



 

Top
  
 
  Search
 
    Similar in PUBMED
   Search Pubmed for
   Search in Google Scholar for
 Related articles
    Access Statistics
    Email Alert *
    Add to My List *
* Registration required (free)  

 
  In this article
    Abstract
   Introduction
    Materials and Me...
   Results
   Discussion
   Conclusion
    References
    Article Figures
    Article Tables

 Article Access Statistics
    Viewed800    
    Printed14    
    Emailed0    
    PDF Downloaded154    
    Comments [Add]    

Recommend this journal