Table of Contents    
ORIGINAL ARTICLE
Year : 2019  |  Volume : 10  |  Issue : 3  |  Page : 123-125  

Screening of intronic mutation IVS9+141A>G in an Indonesian patient with Gaucher disease


1 Department of Biology, Faculty of Mathematics and Natural Science, Universitas Indonesia, Depok, Indonesia
2 Human Genetic Research Center, Indonesian Medical Education and Research Institute, Universitas Indonesia, Jakarta, Indonesia
3 Human Genetic Research Center, Indonesian Medical Education and Research Institute, Universitas Indonesia; Department of Pediatric, Universitas Indonesia, RSUPN Dr. Cipto Mangunkusumo, Jakarta, Indonesia

Date of Web Publication14-Jan-2020

Correspondence Address:
Damayanti Rusli Sjarif
Komplek Depnaker Rt.008/002, Jl. Empang Tiga Dalam No. 13, Pejaten Timur, Jakarta Selatan, 12510, Jakarta
Indonesia
Login to access the Email id

Source of Support: None, Conflict of Interest: None


DOI: 10.4103/jnsbm.JNSBM_79_19

Rights and Permissions
   Abstract 


Objective: Gaucher disease (GD) is an autosomal recessive lysosomal storage disorder caused by the accumulation of the glycolipid glucosylceramide encoded by the GBA gene in certain organs. At present, more than 460 GBA intronic mutations have been reported in several subpopulations worldwide, but many have never been reported in Indonesia. Here, we aimed to screen for intronic mutations of GBA that might be present in patients with GD in Indonesia. Materials and Methods: Blood samples from patients with and without GD were obtained from the National Dr. Cipto Mangunkusumo Referral Hospital, Jakarta, Indonesia. Genomic DNA samples from peripheral leukocytes were extracted, purified, and amplified using the polymerase chain reaction (PCR) with specific primers. Products of PCR were visualized by gel electrophoresis and were further sequenced to analyze the presence of mutations in intron (intervening sequence [IVS]) 9 of GBA. Results: A mutant allele was identified at IVS9+141A>G, discovered at nucleotide 9335 in IVS 9. This mutation had been reported in India before and was categorized as nonpathogenic. Conclusion: Our study may be used as supplemental information for the GD database in Indonesia and will also open new research opportunities for predicting splicing processes in other intronic variants among patients with GD in Indonesia.

Keywords: Gaucher disease, GBA gene, glucocerebrosidase, IVS9+141A>G mutation


How to cite this article:
Aji RP, Lestari IC, Priambodo R, Hafifah CN, Sjarif DR. Screening of intronic mutation IVS9+141A>G in an Indonesian patient with Gaucher disease. J Nat Sc Biol Med 2019;10, Suppl S1:123-5

How to cite this URL:
Aji RP, Lestari IC, Priambodo R, Hafifah CN, Sjarif DR. Screening of intronic mutation IVS9+141A>G in an Indonesian patient with Gaucher disease. J Nat Sc Biol Med [serial online] 2019 [cited 2020 May 30];10, Suppl S1:123-5. Available from: http://www.jnsbm.org/text.asp?2019/10/3/123/275603




   Introduction Top


Gaucher disease (GD) is an autosomal recessive lysosomal storage disorder caused by the accumulation of glycosphingolipid glucosylceramide (GC) in certain organs.[1] It results from the inability of the lysosomal enzyme beta-glucocerebrosidase (GCase) to catalyze GC to glucose and ceramide.[2] Clinical manifestations among patients with GD vary according to the type of disease.[1],[3] Deficiencies in GCase are caused by mutations in the gene (GBA) that it encodes. This gene has 11 exons and 10 introns located on chromosome 1q21 with a length of 7.5 kb.[4] At present, more than 460 GBA mutations have been reported in several subpopulations worldwide, and some of them are intronic.[5] Such regions have important impacts on the GBA gene sequence. Changes in nucleotide bases in these regions disturb the protein structure of GCase by disrupting the splicing process. As a consequence, the severity of these intronic mutations might be mild or severe compared with exonic mutations.[6] Mutations in the intronic or intervening sequence (IVS) in the GBA gene have been widely recorded in the previous studies.[7],[8],[9],[10] However, many of these mutations have never been reported in Indonesia. Therefore, our aim was to screen for the intronic mutations of GBA gene that might be present in patients with GD in Indonesia.


   Materials and Methods Top


Blood samples of two patients with GD and thirty non-GD patients were collected from the National Dr. Cipto Mangunkusumo Referral Hospital, Jakarta, with approved by the hospital's ethics committee. The blood collection process was carried out by a healthcare professional, who followed the procedure based on ethical approval of the Ethical Clearance Committee. Informed consent was signed and approved by the participants whose blood samples were collected. Genomic DNA was extracted from peripheral blood leukocytes using Geneaid Genomic Blood/Cell DNA Mini Kits (GB100) (GeneAid Biotech Lt, New Taipei City, Taiwan). Extracted DNA was quantified for purity and concentration using a UV Lux spectrophotometer and stored at −20°C until further processing.

Polymerase chain reaction (PCR) amplification was performed using specific primers for exons 9–11 in the GBA gene. This area was chosen because it has been recorded to have clear intron variations. Primers used in this study were: Forward, 5′–GAACCATGATTCCCTATCTTC–3′; and reverse, 3′–CTGGGGCTTACTGATCTTTT–5′ as reverse and their product is 1334 bp. Cycling conditions were as follows: initial denaturation at 95°C for 60 s, 40 cycles of denaturation at 95°C for 15 s, annealing at 55°C for 15 s, and elongation at 72°C for 30 s, with final extension at 72°C for 10 min. The total reaction volume for PCR was 10 μL following the MyTaq DNA Polymerase protocol. Some PCR products were visualized using 1.5% agarose gel electrophoresis at 100 V for 60 min. The remaining PCR products were sequenced at 1st Base Provider in Singapore and aligned against the GBA reference gene sequence (NM_000157) and non-GD control sequence to identify mutations. One identified mutation was entered into the dbSNP NCBI (https://www.ncbi.nlm.nih.gov/snp) to check for its novelty, and and Human Splicing Finder version 3.1 [Aix Marseille Université] was applied to check for the impact it would have on the gene-splicing process.


   Results Top


Screening for intronic variations in IVS 9–10 of GBA identified a mutation found in intron 9 in samples from both patients with GD. This mutation is located at nucleotide position 141 from IVS 9, as shown in [Figure 1]. The substitution of adenine (A) to guanine (G) in this position did not affect the splicing site. The IVS9+s141A>G sequence is a single-nucleotide polymorphism variant that has been found in the previous studies and is recorded in the dbSNP database (rs.28373017).
Figure 1: IVS9 sequence comparison of two patients with Gaucher disease and thirty nonGaucher disease control (WT)

Click here to view



   Discussion Top


The mutation in the intron that we found (IVS9+141A>G) is consistent with previous findings and does have any pathogenic effect.[11] This discovery could open up new opportunities for research into other intron variants in patients with GD in Indonesia. Mutations in other IVS regions could have different impacts on the splicing process.

Mutations in introns can trigger pseudo-exon inclusion. This process is caused by mutations that create or disrupt splicing enhancer or silencer elements. The most common mechanism is related to mutations that generate new donor sites and activate preexisting noncanonical acceptor splice sites.[12] The IVS9+141A>G mutation we found here is predicted by Human Splicing Finder to have no impact on exonic splicing silencer sites. Therefore, further research regarding the possibility of splicing processes generated in the IVS9+141A>G mutation needs to be conducted, as well as in other introns.


   Conclusion Top


We found that the IVS9+141A>G mutation also occurred in these two Indonesian patients with GD, consistent with previous studies. This might open possibilities for further research on the screening for other GBA introns in such patients.

Acknowledgments

This work was supported by a Publikasi International Terindeks Untuk Tugas Akhir Mahasiswa UI (PITTA) Grant 2018 funded by Directorate of Research and Community Service Universitas Indonesia, University of Indonesia (No. 5000/UN2.R3.1/HKP. 05.00/2018).

Financial support and sponsorship

This research was supported by grants from Hibah PITTA Universitas Indonesia. The 3rd ICE on IMERI committee supported the peer review and manuscript preparation of this article.

Conflicts of interest

There are no conflicts of interest.



 
   References Top

1.
Sidransky E, Tsuji S, Martin BM, Stubblefield B, Ginns EI. DNA mutation analysis of gaucher patients. Am J Med Genet 1992;42:331-6.  Back to cited text no. 1
    
2.
Erickson AH, Ginns EI, Barranger JA. Biosynthesis of the lysosomal enzyme glucocerebrosidase. J Biol Chem 1985;260:14319-24.  Back to cited text no. 2
    
3.
Beutler E. Gaucher disease: New molecular approaches to diagnosis and treatment. Science 1992;256:794-9.  Back to cited text no. 3
    
4.
Hruska KS, LaMarca ME, Scott CR, Sidransky E. Gaucher disease: Mutation and polymorphism spectrum in the glucocerebrosidase gene (GBA). Hum Mutat 2008;29:567-83.  Back to cited text no. 4
    
5.
Kang L, Wang Y, Gao X, Qiu W, Ye J, Han L, et al. Genotypes and phenotypes in 20 Chinese patients with Type 2 gaucher disease. Brain Dev 2018;40:876-83.  Back to cited text no. 5
    
6.
Malini E, Grossi S, Deganuto M, Rosano C, Parini R, Dominisini S, et al. Functional analysis of 11 novel GBA alleles. Eur J Hum Genet 2014;22:511-6.  Back to cited text no. 6
    
7.
Beutler E, Gelbart T, Kuhl W, Zimran A, West C. Mutations in jewish patients with gaucher disease. Blood 1992;79:1662-6.  Back to cited text no. 7
    
8.
Siebert M, Bock H, Michelin-Tirelli K, Coelho JC, Giugliani R, Saraiva-Pereira ML, et al. Novel mutations in the glucocerebrosidase gene of Brazilian patients with gaucher disease. JIMD Rep 2013;9:7-16.  Back to cited text no. 8
    
9.
Suwannarat P, Keeratichamroen S, Wattanasirichaigoon D, Ngiwsara L, Cairns JR, Svasti J, et al. Molecular characterization of Type 3 (neuronopathic) gaucher disease in Thai patients. Blood Cells Mol Dis 2007;39:348-52.  Back to cited text no. 9
    
10.
Dominissini S, Buratti E, Bembi B, Baralle M, Pittis MG. Characterization of two novel GBA mutations causing gaucher disease that lead to aberrant RNA species by using functional splicing assays. Hum Mutat 2006;27:119.  Back to cited text no. 10
    
11.
Yadav R, Kapoor S, Madhukar M, Manja R, Pal PK, Kumar A. Genetic analysis of the glucocerebrosidase gene in Indian patients with Parkinson's disease (P1.002). Neurology 2017;88:1649-54.  Back to cited text no. 11
    
12.
Vaz-Drago R, Custódio N, Carmo-Fonseca M. Deep intronic mutations and human disease. Hum Genet 2017;136:1093-111.  Back to cited text no. 12
    


    Figures

  [Figure 1]



 

Top
  
 
  Search
 
    Similar in PUBMED
   Search Pubmed for
   Search in Google Scholar for
 Related articles
    Access Statistics
    Email Alert *
    Add to My List *
* Registration required (free)  

 
  In this article
    Abstract
   Introduction
    Materials and Me...
   Results
   Discussion
   Conclusion
    References
    Article Figures

 Article Access Statistics
    Viewed241    
    Printed8    
    Emailed0    
    PDF Downloaded38    
    Comments [Add]    

Recommend this journal