Table of Contents    
ORIGINAL ARTICLE
Year : 2019  |  Volume : 10  |  Issue : 3  |  Page : 109-112  

Mutation analysis of exon 8 of the iduronate-2-sulfatase gene in mucopolysaccharidosis type II patients in Indonesia


1 Human Genetic Research Center, Indonesian Medical Education and Research Institute; Department of Biology, Faculty of Mathematics and Natural Sciences, Universitas Indonesia, Jakarta, Indonesia
2 Human Genetic Research Center, Indonesian Medical Education and Research Institute, Universitas Indonesia, Jakarta, Indonesia
3 Human Genetic Research Center, Indonesian Medical Education and Research Institute; Department of Pediatric, Faculty of Medicine, Cipto Mangunkusumo National Referral Hospital; Department of Medical Biology, Faculty of Medicine, Universitas Indonesia, Jakarta, Indonesia
4 Human Genetic Research Center, Indonesian Medical Education and Research Institute; Department of Biology, Master Program in Biomedical Sciences, Faculty of Medicine, Universitas Indonesia, Jakarta, Indonesia
5 Human Genetic Research Center, Indonesian Medical Education and Research Institute; Department of Pediatric, Faculty of Medicine, Cipto Mangunkusumo National Referral Hospital, Universitas Indonesia, Jakarta, Indonesia

Date of Web Publication14-Jan-2020

Correspondence Address:
Damayanti Rusli Sjarif
Komplek Depnaker RT.008/002, Jl. Empang Tiga Dalam No. 13, Pejaten Timur, Jakarta Selatan 12510, Jakarta
Indonesia
Login to access the Email id

Source of Support: None, Conflict of Interest: None


DOI: 10.4103/jnsbm.JNSBM_44_19

Rights and Permissions
   Abstract 


Objective: Mucopolysaccharidosis II (MPS II), also known as Hunter syndrome, is a rare, recessive, X-linked lysosomal storage disorder caused by a deficiency of lysosomal enzyme iduronate-2-sulfatase (IDS), encoded by IDS gene. I2S plays an important role in the lysosomal degradation of dermatan sulfate and heparan sulfate, with I2S deficiency leading to the accumulation of these glycosaminoglycans in the tissues. Materials and Methods: Exon-specific analyses of IDS exon 8 from eight Indonesian patients with MPS II from Cipto Mangunkusumo Hospital, Jakarta, Indonesia, were performed using polymerase chain reaction and sequencing-based methods. Results: Two novel mutations and a deletion variant of exon 8 were identified among the patients. A single-nucleotide deletion variant (c.1023delA), causing a frameshift in the corresponding amino acid sequence (p.Glu341AspfsTer19), was observed in all patients. In addition, a novel missense mutation (c.1033T>C) resulting in a tryptophan to arginine substitution (p.Trp345Arg), along with a single-nucleotide deletion (c.1041delA) resulting in a second frameshift in the amino acid sequence (p.Lys347AsnfsTer13), was also observed in one patient. Conclusion: This study provides the first mutation analysis of exon 8 of IDS and successfully identified mutations within the IDS gene that may be associated with MPS II. These findings will be added to the IDS gene profile database and may help in the diagnosis of MPS II in future.

Keywords: Deletion, exon 8, IDS gene, lysosomal storage disorder, missense, mucopolysaccharidosis II, novel mutation, polymerase chain reaction


How to cite this article:
Kusno Putri AN, Priambodo R, Ariani Y, Arianto S, Sjarif DR. Mutation analysis of exon 8 of the iduronate-2-sulfatase gene in mucopolysaccharidosis type II patients in Indonesia. J Nat Sc Biol Med 2019;10, Suppl S1:109-12

How to cite this URL:
Kusno Putri AN, Priambodo R, Ariani Y, Arianto S, Sjarif DR. Mutation analysis of exon 8 of the iduronate-2-sulfatase gene in mucopolysaccharidosis type II patients in Indonesia. J Nat Sc Biol Med [serial online] 2019 [cited 2020 Sep 24];10, Suppl S1:109-12. Available from: http://www.jnsbm.org/text.asp?2019/10/3/109/275588




   Introduction Top


Mucopolysaccharidosis II (MPS II), or Hunter syndrome, is a rare X-linked recessive disease which is most commonly seen in males. The disease is divided into two main categories: “severe” (early onset) and “mild” (late onset), based on the symptoms and severity of the disease.[1] A variety of clinical manifestations are believed to be caused by mutations within the IDS gene that affect gene stability and its function.[2]

IDS is 28 kb in length and contains nine exons.[3] In MPS II cases, mutations within IDS cause a deficiency of the corresponding lysosomal enzyme, iduronate-2-sulfatase (IDS), which plays a role in the degradation of glycosaminoglycan (GAG) molecules (dermatan sulfate and heparan sulfate) by breaking down sulfate bonds. IDS deficiency results in the accumulation of GAG molecules, resulting in the development of MPS II. Disease-associated mutations within the IDS gene can occur in any of the nine exons. In this study, we analyzed exon 8 of the IDS gene to identify mutations that may help further our understanding of MPS II and aid in the diagnosis of this rare disease.


   Materials and Methods Top


We analyzed DNA samples from eight Indonesian MPS II patients from the Cipto Mangunkusumo National Referral Hospital along with 50 samples from normal individuals. DNA was isolated from blood using a Blood/Cell DNA Mini Kit from Geneaid. The blood collection process was carried out by a health-care professional, who followed the procedure based on the ethical approval of the Ethical Clearance Committee. Informed consent was signed and approved by the participants whose blood samples were collected. The IDS gene was polymerase chain reaction – amplified using exon 8-specific primers designed in this study (forward primer: TTCATTTTCTGTCATTCTGTGC and reverse primer: TGTCAAGCAATATCATTTCAGCA). The primers were designed using NCBI Primer-Blast (https://www.ncbi.nlm.nih.gov/tools/primer-blast/index.cgi?LINK_LOC=BlastHome). The resulting amplicons were then sequenced using a Sanger sequencing approach by the 1st BASE (Kuala Lumpur, Malaysia). The sequencing results were analyzed to find the variation in IDS gene of each sample. The novelty of variations in IDS gene was checked in the database and recent publication.


   Results Top


Sequence analysis of exon 8 of the IDS gene from eight MPS II patients and 50 normal controls identified three mutations. The three mutations included deletion mutation c.1023delA, present in all eight MPS II patients, and missense mutation c.1033T>C and deletion mutation c.1041delA in MPS II patient P6 [Figure 1].
Figure 1: Mutations identified within exon 8 of the IDS gene in mucopolysaccharidosis II patients. (a) Deletion mutation c.1023delA. (b) Missense mutation c.1033T>C. (c) Deletion mutation c.1041delA. Highlighting indicates conserved amino acids within a column (generated using BioEdit software)

Click here to view


BioEdit software [Carlsbad, CA] was used to predict the corresponding amino acid sequences of each of the exon 8 regions, allowing amino acid changes caused by the observed mutations to be identified [Figure 2]a. Deletion mutation c.1023delA resulted in a frameshift mutation in the amino acid sequence (p. Glu341AspfsTer19) [Figure 2]b, while missense mutation c.1033T>C resulted in a tryptophan to arginine substitution (p. Trp345Arg) [Figure 2]c. In addition, deletion mutation c.1041delA resulted in another frameshift in the amino acid sequence (p. Lys347AsnfsTer13) [Figure 2]d. The mutation of exon 8 in the IDS gene was shown in [Table 1]. Some mutations were already reported, and some of them were novel mutations. Deletion in c.1023delA was found in eight samples and was already reported, while substitution in c.1033T>C and deletion in c.1041delA were novel.
Figure 2: Putative amino acid alterations resulting from the mutations in mucopolysaccharidosis II patients. Highlighting indicates conserved amino acids within a column (generated using BioEdit software). (a) All amino acid alterations in all patients. (b) Alterations in amino acid sequences caused by the c.1023delA deletion (p.Glu341AspfsTer19) in all patients. (c) Alterations in amino acid sequences caused by the c.1033T>C missense mutation (p.Trp345Arg) in P6. (d) Alterations in amino acid sequences caused by the c.1041delA deletion (p.Lys347AsnfsTer13) in P6

Click here to view
Table 1: Mutations observed within exon 8 of the iduronate-2-sulfatase gene in Indonesian patients with mucopolysaccharidosis II

Click here to view



   Discussion Top


A single-base deletion (c.1023delA) was observed in exon 8 of the IDS gene of all eight patients with MPS II. The deletion resulted in a frameshift in the corresponding amino acid sequence, changing the sequence composition (p. Glu341AspfsTer19). The c.1023delA deletion mutation was previously reported by Vafiadaki et al. in a patient with severe MPS II.[4] The frameshift in the amino acid sequence alters as many as 18 amino acids before the stop codon, meaning that translated RNA cannot be processed into functional IDS enzyme. According to the American College of Medical Genetics and Genomics (ACMG) classification guidelines, c.1023delA can be classified as a pathogenic variant of the IDS gene.[5]

Missense mutation c.1033T>C was only observed in one MPS II patient (P6) and resulted in the p. Trp345Arg tryptophan to arginine alteration. While the c.1033T>C missense mutation has not previously been reported, a tryptophan to arginine alteration at the same location (residue 345) was reported by Amartino et al. in 2014.[6] Further, a TGG→TGT missense mutation at residue 345, resulting in a tryptophan to cysteine substitution, was reported by Popowska et al.[7] Based on these data, the c.1033T>C missense mutation observed in the current study appears to be a novel mutation. Therefore, based on the ACMG classification guidelines, c.1033T>C can be classified as a pathogenic variant of IDS.[5]

The c.1041delA deletion mutation was observed in one of the MPS II patients (P6) and five normal controls (two males and three females). This mutation leads to a frameshift that causes a change in the amino acid composition, occurring at p. Lys347AsnfsTer13, and has not previously been reported. However, there is one report of a single-nucleotide alteration (AAA→ATA) at the same codon location (residue 347).[8] Based on these data, we concluded that the c.1041delA deletion mutation is also novel. According to the ACMG classification guidelines, c.1041delA should be classified as a variant of uncertain significance because it demonstrates neither pathogenic nor benign variant criteria; hence, its effects on an individual are unknown.[5] However, this mutation has the potential to be related to MPS II, as it was observed in normal female subjects. MPS II shows an X-linked recessive inheritance pattern and can therefore be inherited from female carriers. Finally, deletion mutation c.1041delA causes amino acid sequence changes at Lys347, one of the substrate-binding/catalytic residues within the active site of IDS. Lys347 is one of nine active-site residues of IDS that are highly conserved and plays a role in proton transfer or water activation during the reaction cycle.[9] Changes in amino acids that occur as a result of p. Lys347AsnfsTer13 affect the active site of IDS by changing the enzyme structure, which likely also affect enzyme activity. A list of all observed mutations is provided in [Table 1].


   Conclusion Top


In conclusion, two novel mutations and one variant that may alter the structure and function of the IDS enzyme were identified in Indonesian patients with MPS II. These findings suggest that other mutations or variants of exon 8 or other exons of the IDS gene may also be responsible for disease in some patients. The findings also show that patients from Indonesia have unique mutations and variations of IDS. Therefore, further analysis of exon 8 and the other exons of IDS is necessary to identify additional mutations within the gene.

Acknowledgments

This research was funded by grants from HIBAH PITTA Universitas Indonesia.

Financial support and sponsorship

This research was supported Direktorat Riset dan Pengabdian Masyarakat (DRPM) UI and Ministry of Research, Technology, and Higher Education of the Republic of Indonesia. The 3rd ICE on IMERI (International Conference and Exhibition on Indonesian Medical Education and Research Institute) committee supported the peer review and manuscript preparation of this article.

Conflicts of interest

There are no conflicts of interest.



 
   References Top

1.
Wraith JE, Scarpa M, Beck M, Bodamer OA, De Meirleir L, Guffon N, et al. Mucopolysaccharidosis type II (Hunter syndrome): A clinical review and recommendations for treatment in the era of enzyme replacement therapy. Eur J Pediatr 2008;167:267-77.  Back to cited text no. 1
    
2.
Lin SP, Chang JH, Lee-Chen GJ, Lin DS, Lin HY, Chuang CK. Detection of Hunter syndrome (mucopolysaccharidosis type II) in Taiwanese: Biochemical and linkage studies of the iduronate-2-sulfatase gene defects in MPS II patients and carriers. Clin Chim Acta 2006;369:29-34.  Back to cited text no. 2
    
3.
Flomen RH, Green EP, Green PM, Bentley DR, Giannelli F. Determination of the organisation of coding sequences within the iduronate sulphate sulphatase (IDS) gene. Hum Mol Genet 1993;2:5-10.  Back to cited text no. 3
    
4.
Vafiadaki E, Cooper A, Heptinstall LE, Hatton CE, Thornley M, Wraith JE. Mutation analysis in 57 unrelated patients with MPS II (Hunter's disease). Arch Dis Child 1998;79:237-41.  Back to cited text no. 4
    
5.
Richards S, Aziz N, Bale S, Bick D, Das S, Gastier-Foster J, et al. Standards and guidelines for the interpretation of sequence variants: A joint consensus recommendation of the American college of medical genetics and genomics and the association for molecular pathology. Genet Med 2015;17:405-24.  Back to cited text no. 5
    
6.
Amartino H, Ceci R, Masllorens F, Gal A, Arberas C, Bay L, et al. Identification of 17 novel mutations in 40 Argentinean unrelated families with mucopolysaccharidosis type II (Hunter syndrome). Mol Genet Metab Rep 2014;1:401-6.  Back to cited text no. 6
    
7.
Popowska E, Rathmann M, Tylki-Szymanska A, Bunge S, Steglich C, Schwinger E, et al. Mutations of the iduronate-2-sulfatase gene in 12 Polish patients with mucopolysaccharidosis type II (Hunter syndrome). Hum Mutat 1995;5:97-100.  Back to cited text no. 7
    
8.
Rathmann M, Bunge S, Beck M, Kresse H, Tylki-Szymanska A, Gal A. Mucopolysaccharidosis type II (Hunter syndrome): Mutation “hot spots” in the iduronate-2-sulfatase gene. Am J Hum Genet 1996;59:1202-9.  Back to cited text no. 8
    
9.
Demydchuk M, Hill CH, Zhou A, Bunkóczi G, Stein PE, Marchesan D, et al. Insights into Hunter syndrome from the structure of iduronate-2-sulfatase. Nat Commun 2017;8:15786.  Back to cited text no. 9
    


    Figures

  [Figure 1], [Figure 2]
 
 
    Tables

  [Table 1]



 

Top
  
 
  Search
 
    Similar in PUBMED
   Search Pubmed for
   Search in Google Scholar for
 Related articles
    Access Statistics
    Email Alert *
    Add to My List *
* Registration required (free)  

 
  In this article
    Abstract
   Introduction
    Materials and Me...
   Results
   Discussion
   Conclusion
    References
    Article Figures
    Article Tables

 Article Access Statistics
    Viewed400    
    Printed14    
    Emailed0    
    PDF Downloaded48    
    Comments [Add]    

Recommend this journal