Table of Contents    
Year : 2011  |  Volume : 2  |  Issue : 2  |  Page : 193-197  

Comparison of real-time polymerase chain reaction assay methods for detection of RHD gene in amniotic fluid

1 Department of Molecular Biology and Genetics, Istanbul University, Faculty of Science, 34134, Turkey
2 Department of Obstetrics and Gynecology, Faculty of Medicine, Istanbul, Turkey
3 Cerrahpasa Faculty of Medicine, Istanbul, Turkey

Date of Web Publication27-Jan-2012

Correspondence Address:
Tuba Gunel
Department of Molecular Biology and Genetics, Istanbul University, Science Faculty, Vezneciler 34118, Istanbul
Login to access the Email id

Source of Support: None, Conflict of Interest: None

DOI: 10.4103/0976-9668.92327

Rights and Permissions

Hemolytic disease of the newborn is the clinical condition in which Rh blood group antigens in couples are incompatible with each other and mother is negative for the antigen, whereas father is positive. Although RHD antigen encoded by RHD gene that is localized on chromosome 1 determines person's Rh genotyping, this incompatibility can lead to delivery as anemia, jaundiced, or dead in mother's uterus. In recent years, improvements have occurred in the prenatal diagnosis of Rh incompatibility. Quantitative real-time polymerase chain reaction (Real-time PCR) has been improved and determining rapidly, reliably, and sensitively has been possible. In this study, the determination of RHD genotyping was investigated using fetal DNA obtained from amniotic fluid and SYBR Green I and TaqMan probe methods were compared, and reliability in prenatal diagnosis of these methods was determined. We studied 35 pregnant women in the second trimester of pregnancy. "SYBR Green I" and "TaqMan" probes results for RHD gene of genomic DNA extracted from total 35 different amniotic fluid samples acquired from 10 RHD (-) and 25 pregnant women randomly were analyzed. DNA extracted from amniotic fluid was analyzed for RHD gene with real-time PCR and the results were then compared with the RHD fetal genotype determined on RHD phenotype of the red blood cells of the infants at birth. The results of RHD TaqMan probes PCR analysis of amniotic fluid DNA were completely concordant with the fetal blood group analysis after birth. Real-time PCR using the TaqMan probes has proven to be more sensitive, accurate, and specific for RHD gene than SYBR Green I method.

Keywords: Blood group antigens, fluorescent dyes, prenatal diagnosis

How to cite this article:
Gunel T, Kalelioglu I, Surmeli Y, Turken B, Ermis H, Aydinli K. Comparison of real-time polymerase chain reaction assay methods for detection of RHD gene in amniotic fluid. J Nat Sc Biol Med 2011;2:193-7

How to cite this URL:
Gunel T, Kalelioglu I, Surmeli Y, Turken B, Ermis H, Aydinli K. Comparison of real-time polymerase chain reaction assay methods for detection of RHD gene in amniotic fluid. J Nat Sc Biol Med [serial online] 2011 [cited 2020 Sep 25];2:193-7. Available from:

   Introduction Top

In the Rh blood group system, RHD is the most important and highly immunogenic antigen, and anti-D isoantibody is the major cause of hemolytic disease of the newborn (HDN) and transfusion reactions. [1] Despite the widespread use of anti-D immunoglobulin prophylaxis (RhIg) to prevent the production of anti-D antibodies by RHD (-) mothers, [2] RHD alloimmunization still remains the major cause of severe hemolytic disease in fetuses and newborns . [ 3] In case mother is RHD (-) and father is heterozygous, HDN is, in 50% of cases, caused by maternal anti-D (IgG) antibody crossing the placenta and binding to fetal red blood cells, followed by their destruction, which results in anemia. [4],[5]

During the past several years, prenatal determination of the fetal Rh blood type has been made by means of DNA testing on amniotic fluid cells. [6] Several polymerase chain reaction (PCR) techniques have been developed for the diagnosis of various genes. The recent advent of a real-time PCR technique has been proven to be useful in various applications, including pathogen detection, gene expression, regulation, and allelic discrimination. Real-time PCR utilizes the 5' nuclease activity of Taq DNA polymerase to cleave a nonextendible, fluorescence-labeled hybridization probe during the extension phase of PCR. The fluorescence of the intact probe is quenched by a second fluorescent dye, usually 6-carboxy-tetramethyl-rhodamine (TAMRA). The nuclease cleavage of the hybridization probe during the PCR releases the effect of quenching, resulting in an increase of fluorescence proportional to the amount of PCR product, and can be monitored by a sequence detector. [7]

SYBR Green I is a minor groove DNA-binding dye, its fluorescence is low; the fluorescence increases when it binds to double-stranded DNA. Among the detection chemistries available for real-time PCR, it is the least expensive, does not require the synthesis of a target-specific probe, and can be used with any pair of primers. Thus, it is particularly useful to develop a real-time quantitative assay when primers, which are known to generate a single product with high yield, are already available. [8]

The human RHD gene has been cloned, [9] and it is absent in RHD (-) subjects. [10] Real-time PCR, [11] which quantifies DNA, can be utilized to detect whether [3] the RHD antigen is present or not. Current study aims to compare the two different methods.

   Material and Methods Top

The ethics committee of Istanbul University, Faculty of Medicine endorsed the study design (protocol number 1532).


We collected 1 ml amniotic fluid samples from 35 pregnant women. We obtained these samples at the department of Gynecology, Cerrahpasa and Istanbul Medical Faculties, Istanbul, Turkey. We used these samples to establish the accuracy of the RHD gene real-time PCR system.

DNA extraction

DNA was extracted from samples of amniotic fluid with High Pure PCR Template Preparation Kit (Roche Diagnostics, Manheim, Germany, Kat.No: 11796828001) according to the manufacturer's instructions. The DNA was eluted into 50 μl elution buffer (10 mM Tris HCl pH 7.4:1 mM EDTA), of which 5 μl was used as a template for the PCR reaction.

Real-time polymerase chain reaction using SYBR Green I

The RHD primers custom was synthesized by Tib MolBiol (Syntheselabor GmbH Eresburgstr. 22-23, D-12103 Berlin, Germany). The primers combinations were as follows: RHD-forward (5'-CCTCTCACTGTTGCCTGCATT-3') and RHD-reverse (5'-AGTGCCTGCGCGAACATT-3'). The real-time PCRs were set up according to the manufacturer's instructions (TaKaRa, SYBR Green I Real-Time PCR Kit, The Biotechnology Company TM Japan) in a reaction volume of 50 μl. The PCR primers were used at a concentration of 900 nmol/l for RHD gene. Five microliters in each of the extracted genomic DNA were used for amplification.

Real-time PCR analysis was performed using a Stratagene Mx3005P. The thermal profile used for RHD gene analysis was as follows: after a 3-minute denaturation at 95 o C, 40 cycles of PCR were carried out after 30 seconds of denaturation at 95 o C and 60 seconds of annealing at 55 o C, and then 30 seconds of extension at 72 o C. Each sample was analyzed in duplicate. The SYBR Green I fluorescent signal was determined for each cycle at the end of the extension step.

Real-time polymerase chain reaction using the TaqMan probe

In this study, the real-time PCR amplification was carried out in a Stratagene Mx3005P. The RHD fluorogenic PCR system consists of the amplification primers RHD-forward (5'-CCTCTCACTGTTGCCTGCATT-3') and RHD-reverse (5'-AGTGCCTGCGCGAACATT-3') and a dual-labeled fluorescent probe, RHD-T (5'(FAM) TACGTGAGAAACGCTCATGACAGCAAAGTCT (TAMRA)3'); FAM [6-carboxyfluorescein] and TAMRA were the fluorescent reporter dye and quencher dye, respectively. The primers and probe were targeted toward the 3' untranslated region (exon10) of the RHD gene. The fluorescent probe contained a 3'-blocking phosphate group to prevent extension of the probe during the PCR. Sequence data for the RHD gene were obtained from the GeneBank data base (accession number, X63097).

The RHD fluorescent probe and primers custom were synthesized by Tib Mol Biol (Syntheselabor GmbH Eresburgstr. 22-23, D-12103 Berlin, Germany) and were used of concentrations of 25 nM and 300 nM, respectively. A total of 5 μl of the extracted amniotic fluid DNA was used for amplification.

   Results Top

Reaction results with SYBR Green I method

When total DNA extracted from amniotic fluid samples from 25 pregnant women, positive and negative controls, and reaction mixture not including DNA used as no template control (NTC) were analyzed with SYBR Green I method, all of results were found to be RHD (+) and NTC was not shown a amplification signal [Figure 1].
Figure 1: Amplification curve acquired result amplification of RHD gene with SYBR Green I method

Click here to view

Reaction results with TaqMan Probe method

When total DNA extracted from amniotic fluid samples from 25 pregnant women used in SYBR Green I method, positive and negative controls, and NTC were analyzed with TaqMan probe method, negative control, NTC, and a sample of belonging to a pregnant woman were RHD (-) [Figure 2].
Figure 2: Amplification curve acquired result amplification of RHD gene with TaqMan probe method

Click here to view

When fetal DNA extracted from amniotic fluid samples from 10 RHD (-) pregnant women, positive and negative controls, and reaction mixture not including DNA used as NTC were analyzed with TaqMan probe and SYBR green method, two samples were found as RHD (-) and eight samples were found as RHD (+) in TaqMan probe method [Table 1].
Table 1: Results of RHD genotyping of fetuses of RHD-negative women with the use of the RHD PCR assay

Click here to view

All the results were confirmed with postnatal serological test and serological test results were same with results acquired with TaqMan probe method.

   Discussion Top

This study aimed at the diagnostic reliability of prenatal RHD diagnosis from amniotic fluid with two different real-time PCR methods. This study showed that Real-time PCR with TaqMan probes is an accurate method for detection of fetal RHD genes. In 1996, Vanden Veyver et al. published their data about 114 amniotic fluid samples in which fetal RHD blood type was determined with PCR. [6] A caveat of this methodology is the requirement of development for appropriate strategies to counter incorrect diagnoses resulting from either false positives (contamination) or false negatives (no fetal DNA present in the sample). [12]

The dsDNA-binding dye SYBR Green I and a TaqMan probe were tested in different real-time PCR systems (Stratagene Mx3005P) to determine the RHD gene in amniotic fluid.

The detection and quantification of gene rearrangement, amplification, translocation, or deletion were significant problems, both in research and in a clinical diagnostic setting. [13]

Real-time PCR analysis is sensitive, reliable, and rapid technique for determining RHD genotyping of genomic DNA extracted from amniotic fluid obtained from RHD (-) pregnant women. [3]

In this study, results obtained with TaqMan probe method were compared with that of SYBR Green I method and the former was found to be more reliable after demonstration. With TaqMan probe method, amplification was not found in negative control and NTC, and one sample was with no RHD DNA and 24 samples were RHD (+) DNA. These results have supported the avoidance of evoking false-positive results because of the sequence-specific complementary of TaqMan probe. [14]

When same samples were analyzed with SYBR Green I method, amplification was found in total of samples. When it was compared with serological results, false-positive result was determined in one sample. These results have supported the hindrance of accuracy because of primer dimers and nonspecific products, which were bound by the SYBR Green I dye. [12] Measurement of the ratio of specific PCR products against nonspecific ones was enabled by determining the melting peak integration.

As TaqMan probe method does not need melting curve analyses and is more sensitive than SYBR Green I, it is suggested for RHD genotyping. [15] When total DNA obtained from amniotic fluid of 10 pregnant women known as RHD (-), negative and positive controls, and NTC were analyzed with TaqMan probe method, amplification was found of eight amniotic fluid samples, while amplification was not found in two amniotic fluid samples [Figure 3]. These results were confirmed with serological tests. Real-time analyses are useful for RHD (-) pregnant women because of their sensitivity to RHD antigens. If the test indicates that the fetus is RHD (-), it can be reassured that the fetus is not at risk. On the other hand, if the test indicates that the fetus is RHD (+), treatment can be planned. The test gives a result in a short period. So, this is an advantage for a period of pregnancy times during the race.
Figure 3: Amplification curve from RhD (-) pregnant women results amplification of RhD gene with TaqMan Probe Method

Click here to view

   References Top

1.Chen JC, Lin TM, Chen YL, Wang YH, Jin YT, Yue CT. RHD 1227A is an important genetic marker for RhD(el) individuals. Am J Clin Pathol 2004;122:193-8.  Back to cited text no. 1
2.Zavala C, Salamanca F. Mothers at risk of alloimmunization to the Rh (D) antigen and availability of gamma-globulin at the Mexican Institute of Social Security. Arch Med Res 1996;27:373-6.  Back to cited text no. 2
3.Lo YM, Hjelm NM, Fidler C, Sargent IL, Murphy MF, Chamberlain PF, et al. Prenatal diagnosis of RhD status by molecular analysis of maternal plasma. N Engl J Med 1998;339:1734-8.  Back to cited text no. 3
4.Avent ND. Antenatal genotyping of the blood groups of the fetus. Vox Sang 1998;74 Suppl 2:365-74.  Back to cited text no. 4
5.Avent ND, Reid ME. The Rh blood group system: A review. Blood 2000;95:375-87.  Back to cited text no. 5
6.Van Den Veyver I, Subramanian SB, Hudson KM, Werch J, Moise KJ Jr, Hughes MR. Prenatal diagnosis of the RhD fetal blood type on amniotic fluid by polymerase chain reaction. Obstet Gynecol 1996; 87:419-422.  Back to cited text no. 6
7.Bustin SA, Mueller R. Real-time reverse transcription PCR and its potential use in clinical diagnosis. Clin Sci (Lond) 2005;109:365-79.  Back to cited text no. 7
8.Heid CA, Stevens J, Livak KJ, Williams PM. Real time quantitative PCR. Genet Res 1996;6:986-94.  Back to cited text no. 8
9.Le van Kim C, Mouro I, Chérif-Zahar B, Raynal V, Cherrier C, Cartron JP, et al. Molecular cloning and primary structure of the human blood group RhD polypeptide. Proc Natl Acad Sci U S A 1992;89:10925-9.  Back to cited text no. 9
10.Colin Y, Chérif-Zahar B, Le Van Kim C, Raynal V, Van Huffel V, Cartron JP. Genetic basis of the RhD-positive and RhD-negative blood group polymorphism as determined by Southern analysis. Blood 1991;78:2747-52.  Back to cited text no. 10
11.Hein I, Lehner A, Rieck P, Klein K, Brandl E, Wagner M. Comparison of different approaches to quantify Staphylococcus aureus cells by real-time quantitative PCR and application of this technique for examination of cheese. Appl Environ Microbiol 2001;67:3122-6.  Back to cited text no. 11
12.Wittwer CT, Herrmann MG, Moss AA, Rasmussen RP. Continuous fluorescence monitoring of rapid cycle DNA amplification. Biotechniques 1997;22:130-1, 134-8.  Back to cited text no. 12
13.Holzgreve W, Hahn S. Prenatal diagnosis using fetal cells and free fetal DNA in maternal blood. Clin Perinatol 2001;28:353-65, ix.  Back to cited text no. 13
14.Szuhai KE, Sandhaus SM, Kolman-Uljee M, Lemaitre JC, Truffert RW, Dirks RW, et al. A novel strategy for human papillomavirus detection and genotyping with SYBR Green and molecular beacon polymerase chain reaction. Am J Pathol 2001;159:1651-60.  Back to cited text no. 14
15.Savlý H, Hatýrnaz O. Quantitative real time-polymerase chain reaction and gene expression analysis in haematology. Turkiye Klinikleri J Med Sci 2004;24:653-60.  Back to cited text no. 15


  [Figure 1], [Figure 2], [Figure 3]

  [Table 1]

This article has been cited by
1 Development and validation of a real-time PCR assay for the detection of Toxoplasma gondii DNA in animal and meat samples
Anna Maria Fausta Marino,Maurizio Percipalle,Renato Paolo Giunta,Antonio Salvaggio,Giulia Caracappa,Tiziana Alfonzetti,Alessandra Aparo,Stefano Reale
Journal of Veterinary Diagnostic Investigation. 2017; 29(2): 203
[Pubmed] | [DOI]
2 Quantification of Alternaria brassicicola infection in the Arabidopsis thaliana and Brassica rapa subsp. pekinensis
M. SuŠudi,J.-M. Park,S.-R. Park,D.-J. Hwang,S.-C. Bae,S. Kim,I.-P. Ahn
Microbiology. 2013; 159(Pt_9): 1946
[Pubmed] | [DOI]
3 Evaluation of bakanae disease progression caused by Fusarium fujikuroi in Oryza sativa L.
In Sun Hwang,Woo-Ri Kang,Duk-Ju Hwang,Shin-Chul Bae,Sung-Hwan Yun,Il-Pyung Ahn
Journal of Microbiology. 2013; 51(6): 858
[Pubmed] | [DOI]
4 Evaluation of Fusarium head blight in barley infected by Fusarium graminearum
Woo-Ri Kang,Duk-Ju Hwang,Shin-Chul Bae,Theresa Lee,Soonok Kim,Il-Pyung Ahn
Journal of Microbiology. 2013; 51(4): 540
[Pubmed] | [DOI]


    Similar in PUBMED
   Search Pubmed for
   Search in Google Scholar for
 Related articles
    Access Statistics
    Email Alert *
    Add to My List *
* Registration required (free)  

  In this article
   Material and Methods
    Article Figures
    Article Tables

 Article Access Statistics
    PDF Downloaded418    
    Comments [Add]    
    Cited by others 4    

Recommend this journal